Review



t100 thermal cycler  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad t100 thermal cycler
    T100 Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 14025 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thermal+cycler/T100+Thermal+Cycler/pmc13092056-118-7-10
    Average 99 stars, based on 14025 article reviews
    t100 thermal cycler - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    DNA Extraction:

    Article Title: ZEB2 orchestrates a transcriptional program to safeguard the integrity of human CD4+ Th1 effector memory cells.
    Article Snippet: .. Cells were pelleted, supernatant was aspirated, and 50 μL of QuickExtract DNA Extraction Solution (Epicenter, Lucigen, Cat# QE0905T) was used to extract genomic DNA, following the manufacturer’s protocol and thermal cycler (T100 Thermal Cycler, Bio-Rad Laboratories) program: 68 �C for 15 minutes, 95 �C for 10 minutes, 4 �C hold. .. Genomic PCR, to amplify the ZEB2 region targeted by the sgRNAs (and control nontargeted ZEB2), was carried out using 25 μL of 2X AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Cat# 4398881), 0.5 μL of 10 μM ZEB2 F Primer TTTCCTGACATGGTTGAGTAATTC, 0.5 μL of 10 μM ZEB2 R Primer AATCTCGTTGTTGTGCCAGG, 2 μL of genomic DNA extract and 22 μL of UltraPure Water (50 μL final volume), using the PCR program 1× at 95 �C for 10 seconds (enzyme activation), 40× at 95 �C for 30 seconds (Denature), 55 �C for 30 seconds (Anneal), and 72 �C for 30 seconds (Extend), followed by 1× at 72 �C for 7 minutes (final extension), hold 4 �C.

    Single Cell:

    Article Title: Single-cell chromatin accessibility landscape of cardiac non-myocytes identifies tissue repair program during heart regeneration
    Article Snippet: .. Briefly, after tagmentation, the cells were loaded on a Chromium Controller Single-Cell instrument to generate single-cell Gel Bead-In-Emulsions (GEMs) followed by linear polymerase chain reaction (PCR) as described in the 10x Genomics scATAC-seq protocol using a Veriti 96-well thermal cycler (1851197, Bio-Rad). .. After breaking the GEMs, the barcoded tagmented DNA was purified with SPRIselect Reagent Kit ( B23318 , Beckman Coulter) and further amplified to enable sample indexing and enrichment of scATAC-seq libraries.

    Polymerase Chain Reaction:

    Article Title: Single-cell chromatin accessibility landscape of cardiac non-myocytes identifies tissue repair program during heart regeneration
    Article Snippet: .. Briefly, after tagmentation, the cells were loaded on a Chromium Controller Single-Cell instrument to generate single-cell Gel Bead-In-Emulsions (GEMs) followed by linear polymerase chain reaction (PCR) as described in the 10x Genomics scATAC-seq protocol using a Veriti 96-well thermal cycler (1851197, Bio-Rad). .. After breaking the GEMs, the barcoded tagmented DNA was purified with SPRIselect Reagent Kit ( B23318 , Beckman Coulter) and further amplified to enable sample indexing and enrichment of scATAC-seq libraries.

    Article Title: Complete genome characterization of potato latent virus infecting Withania somnifera and development of one and two-step RT-PCR for its rapid detection
    Article Snippet: Withania somnifera is a widely used medicinal plant valued for its therapeutic properties.. In this study, W. somnifera was identified as a new natural host of potato latent virus (PotLV), marking the first global report of this infection.. The presence of the virus was confirmed through reverse transcription polymerase chain reaction (RT-PCR), and genome characterization was performed using high-throughput sequencing (HTS) and bioinformatics analysis.

    Article Title: Cloning, purification and possible use of a Bacillus nitroreductase in biotechnological applications.
    Article Snippet: .. PCR was then performed using these primers to amplify the gene using thermal cycler (T100, BIO-RAD). ..



    Similar Products

    98
    TaKaRa thermal cycler dice real time system
    Thermal Cycler Dice Real Time System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thermal+cycler/Thermal+Cycler+Dice+Real+Time+System/custom%40tp1010%4042665111
    Average 98 stars, based on 1 article reviews
    thermal cycler dice real time system - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    90
    Thermo Fisher 7000 thermal cycler
    7000 Thermal Cycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thermal+cycler/nct06102629-7-10-14
    Average 90 stars, based on 1 article reviews
    7000 thermal cycler - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Bio-Rad t100 thermal cycler
    T100 Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thermal+cycler/T100+Thermal+Cycler/pmc13092056-118-7-10
    Average 99 stars, based on 1 article reviews
    t100 thermal cycler - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad cdna
    Cdna, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thermal+cycler/T100+Thermal+Cycler/pmc13092056-118-14-10
    Average 99 stars, based on 1 article reviews
    cdna - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad t100 thermal cycler pcr system
    T100 Thermal Cycler Pcr System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/thermal+cycler/T100+Thermal+Cycler/pmc13090507-214-22-27
    Average 99 stars, based on 1 article reviews
    t100 thermal cycler pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results